Page tree
Skip to end of metadata
Go to start of metadata

You are viewing an old version of this page. View the current version.

Compare with Current View Page History

« Previous Version 69 Next »

Asian Ant Mantis

Odontomantis planiceps (de Haan, 1842)

Life Cycle

Praying mantids are holometabolous insects, in which they undergo three main life stages: egg, nymphs, adults.  This is in contrast to holometabolous insects that have four life stages.



Ootheca

Similar to cockroaches, praying mantids lay their individual eggs in egg cases termed as ootheca.  Each ootheca is a huge investment by a single female because she invests in multiple offspring in one sitting.  The ootheca functions as a shield from environmental stressors such as temperature fluctuations and water damage1 . Many mantids tend to lay on solid surfaces such as branches and stems. But due to the built up environment Singapore has, a lot of urban-adapted species lay their ooths on surfaces like railings, walls, and windows (personal observation).

Ootheca have been known to have the potential to delimit species, if not higher level taxa, due to the variation between different species2 3 .  However, ootheca morphology has been severely understudied throughout literature.  Below are some examples of other ootheca laid/formed by a few common local mantids to show how ootheca morphology can vary between species. 


The emergence area is the location at which the nymphs will hatch from, and this area varies between different types of ootheca too.  During emergence, nymphs hang from string that originate frrom emergence areas, and the nymphs gradually wiggle to free themselves.



Nymphs

Although juvenile morphology is extremely important, it has been neglected in a lot of studies.  Many mantids look like ants during early nymphal stages.  As juveniles are also carnivorous and cannibalistic, as they prey on other arthropods and even their own kind.  Hence, they do have the same ecological significance as adults and deserve just as much attention in research that adults do.

Early instars in other mantises.  It is common for them to adopt ant mimicry too. Featuring: Amantis sp., & unknown mantis nymph (lower right).

But there are also some early instars that don't mimic ants. Featuring nymphs of: Tropidomantis tenera (upper left), Leptomantella sp. (upper middle), Hierodula sp. (lower left & right), Deroplatys sp. (lower right)

Adults

The number of moults taken to reach adulthood differs greatly between species, ranging from 5 to more than 10 (personal observation). The lifespan of adults also differ greatly between species.  However, females tend to have longer lifespans than males in most species, but there are a number of exceptions
1 . Praying mantids also differ greatly in size range, wings, copulation, sperm storage

Reproduction

Most praying mantids undergo obligate sexual reproduction, in which they have to mate to produce offspring.  However, there are a few species that are known to be strictly parthenogenic such as Brunneria borealis, while some have the ability to be facultatively parthenogenic4 .

Life Cycle of Odontomantis planiceps

Just like all other praying mantids, O. planiceps has 3 life stages (egg, nymphs & adults).  This species strictly undergoes sexual reproduction to produce fertile ootheca and offspring.

Ootheca

In O. planiceps, external dorsal walls of ootheca were white and foamy upon formation, but gradually developed into a hue of mustard yellow, with a coarse, scaly surface. They are formed from proximal to distal ends.  The emergence area is where the nymphs will hatch from the ootheca.  For each healthy ootheca laid by an O. planiceps, the hatchlings usually vary between 5 and 30 individuals (personal observation).

Labelled images of an O. planiceps ootheca.

Juvenile/Nymphs

How this species managed to get the common name is because of the uncanning ant mimicry that juveniles adopt1 .  Using this form of mimicry, the young and almost defenceless nymphs are able to camouflage as ants as a defence mechanism5 . Based on the image above, it is clear that many mantids look like ants during early nymphal stages, so it is unclear why only this particular species has been termed as an ant mantis. 

Ant mimicry in this species only persists up to 3rd instar. From the 4th instar onwards, it becomes quite evident that they’re not ants.  In O. planiceps, early instar juveniles can be differentiated through differences in pigments of the raptorial forelegs (unpublished data).  Later instars can be determined through comparison of pigmented patterns in the compound eyes (unpublished data) and dorsal surface colouration. Subadults have enlarged wingbuds.

Adults

Keys available online described the genus as having: rounded bulging eyes, pronotum squat and shorter/as long as anterior coxa with poorly defined supra-coxal bulge, and non-dilated forefemor6 .  These traits were congruent with the morphology of imaged O. planiceps specimens.  Adults of O. planiceps have fully functional wings that extend to the tip of the abdomen, similar to most mantids. Although capable of flight, the females rarely fly due to their gravid abdomen.  Males are highly mobile and quick to fly. This species exhibits sexual size dimorphism, in which females are larger than males (approximately 1.4cm for males and 2.0cm for females).

Female (left) and male (right) pinned specimens.




Interactions

With prey (Diets of mantids)

Mantids are generally stalking or ambush predators, and are only known to eat live prey.  Some aggressive individuals have been known to take down insects as large as them, which includes their mates, lizards, fishes, and small birds7 .  Many predatory insects can be beneficial in agricultural pest suppression.  For example, Tenodera sinensis was introduced into North America as a form of biological pest control8 .  Afterall, mantids are extremely voracious feeders and are able to eat a wide variety of prey items, and has even shown that some mantises are able to gut the toxic innards of caterpillars9


Praying mantids catch prey using a quick striking motion with their forearms, and accuracy is usually high.  Usually, they are stalking or ambush predators1 .However, there are times where the prey are quick to flee or the mantid has generally poor aiming skills.



With predators (Mantids as food)

Mantises have a single ear located at the ventral metathorax10 .  Although it only provides non-directional hearing, it is known to be extra sensitive to ultrasonic sounds. When it senses ultrasonic frequencies commonly used by bats that navigate and forage using echolocation, the mantis is able to fly downwards in a spiral, which helps them to escape predation11 .

Location of the mantis ear


Mantids are also a common prey item for other carnivores such as birds.  Recently, Fluffy, an albino kingfisher has been in the spotlight among birders due to its’ unusual colouration and concern for its’ ability to hunt independently. 

place photo soon. still awaiting permission

With parasites (Mantids as victims)

Horsehair Worms

Horsehair worms are one of the most common parasites that people often associate with mantids, most likely due to the gruesomeness of its emergence.  However, they are not known to be common in Singapore (personal observation).  The worms are parasitic nematomorphs that have a free living stage, intermediate host stage, and the intermediate hosts are consumed by mantids which end up being the final host that gets killed upon emergence of the parasite12 .  The parasite spends the free-living stage in water bodies, hence the intermediate stages only affect insects that spend a portion of their lives in water (ie. aquatic nymphal development).

Obtained from YouTube under Fair Use guidelines


Tachinid Flies

Tachinid flies have been recorded to lay their eggs on juvenile mantises and the larvae then boring into the hosts’ body13 . Symptoms of this form of parasitism include delayed moults and swelling of the mantis’s abdomens. Upon emergence, the individual mantids all died within 48 hours. These larvae burrow in soil and pupate. This type of parasitism has been observed within Singapore (unpublished personal observations), but remains understudied.

Pupa of a tachinid fly

Tachinid fly that emerged


Ootheca Parasitism

Chalcid wasps have been known to parasitise ootheca of mantids too.  These wasps oviposit into the egg chambers of ootheca, and offspring emerge from small holes from the ootheca14 15 .This tends to to reduce the number of individuals that hatch from the ootheca.  Depending on the severity of parasitism, some ootheca might not even be able to yield any offspring.  Recent observations and studies on these wasps have been conducted in regions outside Singapore and Malaysia, and the behaviour and life cycle of the North American Podagrion mantis has been fairly well studied by Breland16 . These wasps have been found to parasitize multiple host species, and all species of Podagrion are known to oviposit solely in the ootheca of praying mantises 17 18

Such parasitism has been observed around Singapore19 , but further studies need to be done to obtain information on species level identification, susceptibility of different ootheca structures, prevalence, specificity of different species, and many more information.

Chalcid wasp, suspected Podagion sp., ovipositing in the ootheca of a Tenodera sp. (Image by: Nicholas Lim)

Podagrion sp. that emerged from a Tropidomantis tenera ootheca

With humans (Mantids in pet trade)

Praying mantids are commonly kept as pets in other countries, and even sold in pet shops.  These countries are often in temperate regions only.  Pet shops tend to stock a wide variety of arthropods, which includes both pet insects and feeder insects, making mantid rearing a breeze.  However, such privileges and access to a wide variety of feeder insects are not available in Singapore, making mantid rearing here difficult.

Mantids are known to be highly susceptible to inbreeding, and cultures of the same genetic line usually do not persist past the 3rd generation.  Hence, it is common practice among breeders to trade individuals or capture a few individuals from the wild to outbreed the existing cultures.

For O. planiceps

Feeding behaviour of O. planiceps individuals are similar to most other mantids as described above. Owing to the lack of research on this particular species, only speculations can be made about the parasitism of these individuals20 , and there is no information on whether they are often eaten by other predators. O. planiceps has been known to be one of the easier species to rear, and is exists in the pet trade1 21 . However, O. planiceps is a tropical species and most countries that have a booming pet trade for praying mantises tend to be temperate regions.  This makes it difficult for them to have a consistent supply of wild individuals to add to the gene pool, and inbreeding becomes a huge problem that leads to the subsequent downfall of the O. planiceps stocks (personal communication with multiple breeders). If you take a look at a website that sells O. planiceps, live stocks are not available22 .





Mantis, mantises, mantid, mantids?

There is a fine line between the correct and incorrect usage of these words.  To make things more confusing than it already is, Mantis is a genus23 . Moreover, Mantidae is a family-level taxonomic rank, and it is usually common to refer to individuals in the family without the '-ae' suffix (for example, individuals in family Sepsidae can be called sepsids).  Hence, there are arguments about whether or not it is right to use the term 'mantis' or 'mantid'.  However, both terms are still very widely used in literature because it is definitely much easier to drop the word 'praying' that precedes it because both 'mantis' and 'mantid' are known to refer to praying mantids24 25 . 'Mantises' and 'mantids' are widely accepted as the plural forms of the 'mantis' and 'mantid' respectively 24 25 .

Another common occurence is calling them 'preying mantises', which is understandable because they indeed do prey on other living things.  However, 'praying' is more widely accepted and prevalent in literature use due to the posture assumed by all individuals in the order Mantodea. 




Etymology

The genus name is a combination of the prefix Odonto- (from Greek word odous, meaning “tooth”) and Mantis, while the species planiceps is derived from a combination of Latin words - planus (meaning “flat”) and ceps (meaning “head”).




Locations of O. planiceps

These mantids seem to be able to thrive in highly disturbed environments and conserved areas.  They can be considered as one of the more urban species, which are more mobile and can be found in areas with very little vegetation

Screenshot of the map of Singapore, taken from iNaturalist (Permission granted). Red markers indicate the location of O. planiceps sightings reported by iNaturalist users, purple markers indicate locations that O. planiceps were personally observed.




Comparison to other local mantids

Being a biodiversity hotspot, it is expected that Singapore is home to a number of other small mantids too.  However, O. planiceps can easily be differentiated from them based on the pigments on the whole body, and also the shape of the head.

Acromantis sp. (left), Amantis sp. (center) & Tropidomantis sp. (right) are all common small mantids in Singapore.





Phylogeny

Lineage

Family Hymenopodidae

bring this up pls Praying mantises of the Hymenopodidae family include fascinating camouflages to blend with vegetation and disguise body profiles. Some species even exhibit variously sized cuticular leg expansions appearing as lobes that resemble foliage. The famous orchid mantid (Hymenopus coronatus) belongs to this family too, and has been observed to resemble flowers and attract more pollinators than an actual flower does26 .  Below are some examples of Hymenopodids, showcasing their astounding mimicry as nymphs and adults. TO FIND AND PUT IMAGES


Phylogenetic Trees & COI Barcode

Parsimonious trees have shown fairly strong support in the evolutionaray history of Odontomantis sp. in relation to other closely related taxa. Strict consensus cladograms obtained from the trees were well supported by morphological variation.  This includes traits such as secondary elongation of female wings (Node 75), number of cercomeres (Node 73), and postero-ventral fore tibial spines being laid down (Node 77).

Image adapted from Wieland, 2013. state support values from paper into caption27


Word document containing the COI sequence for Odontomantis planiceps obtained from Singapore:

TTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCCCATGCATTCATCATAATTTTCTTCATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCACCATCAATTGTTCTTCTTATTTTAAGAAGAACAATTGAAAGAGGTGCAGGTACAGGATGAACAGTTTATCCTCCTTTATCCGCAAGAATTGCTCATGCCGGCCCTGCAGTGGATTTAACTATTTTTTCATTACATTTAGCTGGTATATCGAGAATTATAGGAGCTGTAAATTTTATTACAACTATACTTAATATAAAACCAATTTATATAAATCAATCACAAATACCTTTATTTGTATGATCAGTAGGAATTACCGCATTACTTCTATTATTATCTTTACCAGTATTAGCTGGTGCAATCACAATATTATTAACTGATCGAAATATTAATACATCATTTTTCGACCCAGCAGGAGGTGGTGATCCAATCTTATATCAACACTTATTTTGATTTTTTGGTCA




Taxonomy

say i tried to find the species description but cant and only got genus. talk about how the types are under synonyms anot. if a species/genus has changed, the type is still stuck to the species. Sometimes, different names are assigned to the same species, especially when a species that has already been described earlier was described again.  The names that come after the initial naming and descriptions are considered as junior synonyms and should not be used in nomenclature.

In the case of Odontomantis (Saussure, 1871) as a genus, Antissa (Stal, 1871) and Euantissa (Giglio-Tos, 1927) were classified as junior synonyms. For species-level names, javana (Saussure, 1870) was classified as a junior synonym.  Hence, the species should be referred to as Odontomantis planiceps (de Haan, 1842).

Unfortunately, a wide variety of names have been incorrectly used to describe the species.  It is not uncommon to come across information describing Euantissa sp28 29 .  Moreover, wrong references for the species name has been quite prevalent too, with people calling it Odontomantis planiceps (Giglio-Tos, 1913)30 , despite de Haan (1842) being the accurate name.

Type specimens

As opposed to information stated on Mantodea Species File Online31 , personal communication with curators from Natural History Museum of Geneva revealed that the female specimen has been transferred to RMNH Leiden (Naturalis Biodiversity Center in Leiden). The syntype for O. javana (female) and male holotype filed under O. planiceps are currently stored in RMNH Leiden.



References

Footnotes
Ref Notes
1 McMonigle, 2013 [ a b c d e ]
2 Breland & Dobson, 1947
3 Brannoch et al., 2017
4 Mantis Study Group, 1996
5 Huang et al., 2011
6 Mantodea Species File Online, 1997
7 Battiston et al., 2018
8 Frank, 2015
9 Mebs et al., 2017
10 Yager & Hoy, 1986
11 Triblehorn & Yager, 2002
12 Schmidt-Rhaesa & Ehrmann, 2001
13 Young, 2009
14 Fagan & Folarin, 2001
15 Panis & Laudeho, 2008
16 Breland, 1941
17 Coombs, 1994
18 Fox, 1939
19 Lum & Ho, 2018
20 Lum, 2018
21 Mantis Place
22 Mantis Place
23 University of Kentucky College of Agriculture
24 English Language and Usage, 2015 [ a b ]
25 The American Heritage Dictionary of the English Languge [ a b ]
26 O’Hanlon et al., 2013
27 Wieland, 2013
28 Encyclopedia of Life
29 Tree of Life web project
30 Academic Dictionaries and Encyclopedias
31 Mantodea Species File Online











tbd:

32

  • No labels