Pin-striped Tit-Babbler
Mixornis gularis (Horsfield, 1822)
In the field, however, these characteristics can be difficult to make out, especially in the dimly lit forest understorey. In spite of this, Pin-striped Tit-Babblers remain relatively easy to identify in the field due to their distinctive 'chonk-chonk-chonk' call (See Vocalisation) and their habit of traveling in small flocks near the ground .
| Single cite | ||
|---|---|---|
| ||
Wells, D. 2007. Birds of the Thai-Malay Peninsula: Passerines: Volume 2. Page 848 in. Christopher Helm Publishers Ltd. |
| Anchor | ||||
|---|---|---|---|---|
|
Song
The song of the Pin-striped Tit-Babbler varies somewhat, although it generally consists of a single, loud and far-carrying "chonk" (sometimes described as "ch'nk" or "chunk") note repeated over and over again, in cycles of three to four notes repeated every two to three seconds, with the initial note slightly lower pitched than the rest. Longer songs can also feature a sequence of 28 notes delivered every 10 seconds. The duration of the song varies, although individuals have been observed vocalising for as long as five minutes continuously
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
Regional variations in the song are documented below
| Single cite | ||
|---|---|---|
| ||
Robson, C. 2008. A field guide to the birds of South-East Asia. Page 544 in. New Holland Publishers. |
- North Vietnam: Repeated loud clear bouncing tichui-chutut-chut or tit-chutut-chutut-chutut...
- Central Annam and Thailand: chut-chut-chut-chut-chut...
Call
The calls of the Pin-striped Tit-Babbler generally consist of contact calls made among group members, and usually occurs simultaneously between two or more individuals of the flock. The contact calls consist of a low, hoarse two-note "chrrt-chrr" that can often be heard in rapid succession when several birds call one after the other. Other contact calls include another harsh, rasping two-note "tititit-chrreeoo" call
| Single cite | ||
|---|---|---|
| ||
Robson, C. 2008. A field guide to the birds of South-East Asia. Page 544 in. New Holland Publishers. |
.
The video clip below recorded by Lena Chow in Singapore contains both the song as well as the contact-call.
Widget Connector url http://youtube.com/watch?v=DJfPmqt-qbg
Biology and Behaviour
Adapted from Collar and Robson (2007), Robson (2008) and Wells (2007)
Habitat
Pin-striped Tit-Babblers are forest birds that exhibit a fairly broad range of tolerance for various types of wooded habitats ranging from poor-quality scrub to pristine lowland tropical rainforest. In back-mangrove areas, they can usually be found in the forest interior and crown, while generally preferring to remain in the mid-strata and canopy areas of lowland dry-land forests, peat swamps and freshwater swamp forests. In lower quality habitats such as secondary forest and overgrown orchards, they can often be found at the forest edge. Other degraded habitats where the Pin-striped Tit-Babbler can be found include bamboo groves and secluded cover in parklands and large gardens. Pin-striped Tit-Babblers can also be found on the edges of montane to sub-montane areas up to an elevation of approximately 1,000m above sea level in the Indian subcontinent and China, and up to 1,525m above sea level in Southeast Asia and Palawan
| Single cite | ||
|---|---|---|
| ||
Wells, D. 2007. Birds of the Thai-Malay Peninsula: Passerines: Volume 2. Page 848 in. Christopher Helm Publishers Ltd. |
.
Foraging and Food
While their foraging behaviour of the is generally poorly studied
| Single cite | ||
|---|---|---|
| ||
Wells, D. 2007. Birds of the Thai-Malay Peninsula: Passerines: Volume 2. Page 848 in. Christopher Helm Publishers Ltd. |
, the Pin-striped Tit-Babblers are known to feed mostly on insects, including small beetles, ants, caterpillars, grasshoppers and spiders. Fruit is also consumed on occasion. The Pin-striped Tit-Babbler forages in parties of up to 12 or more individuals, although generally remaining in pairs during the breeding season, probing for food on bark surfaces, in trapped litter and in clumps of epiphytic orchids, amongst other things. In tall inland forest, the Pin-striped Tit-Babbler can often be found in mixed-species flocks, which often includes other small babbler species. Foraging occurs at or near the ground, although flocks often climb vine-laden trees up to a height of 6 - 9m above the ground
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
| Widget Connector | ||
|---|---|---|
|
Breeding
Pin-striped Tit-Babblers tend to breed between the months of February and July, although breeding has been recorded from December to August in Peninsular Malaysia. The nest is usually a round ball or dome with a side entrance constructed using dead bamboo, bark strips, leaves, palm strands, debris and plant fibres, placed close to the ground (between 0.3 to 6m above ground) in bushes, palms, bamboo clumps or dense undergrowth. Clutch sizes vary between 2 to 5, with eggs appearing fairly glossy white to dull white (sometimes faintly pinkish-tinged) or sea-green
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
. The Pin-striped Tit-Babbler has also been recorded being brood parasitised by the Drongo Cuckoo (Surniculus lugubris)
| Single cite | ||
|---|---|---|
| ||
Lee, C. 2010. Pin-striped Tit-Babbler Feeding Drongo Cuckoo Fledgling. Bird Ecology Study Group. [Online.] Available at http://www.besgroup.org/2010/06/22/pin-striped-tit-babbler-feeding-drongo-cuckoo-fledgling/. |
.
| Anchor | ||||
|---|---|---|---|---|
|
Widely distributed across Southeast Asia and extending north and west to China and India respectively, the Pin-striped Tit-Babbler exhibits a range of intraspecific variation across its geographic range with 14 subspecies currently recognised.
| **From Clements Checklist 6.8 (2013)
# M. g. rubicapilla: Lowlands of E Nepal to NE India and extreme N Myanmar# M. g. ticehursti: W Myanmar (Upper Chindwin District to Arakan
|
Conservation Status
The Pin-striped Tit-Babbler has been categorised by the International Union for Conservation of Nature (IUCN) as Least Concern owing to its large range as well as its large and stable population size. It is a resident species across its geographic range and is not known to display migratory behaviour
| Single cite | ||
|---|---|---|
| ||
BirdLife International. 2013. Macronous Gularis. IUCN 2013. IUCN Red List of Threatened Species. Version 2013.2. [Online.] Available at http://www.iucnredlist.org/details/22735162/0. |
.
Diagnostics
Original Description
"The entire length of the Timalia gularis is five inches. Upper parts brown, with a rufous tint; inclining to olivaceous on the nape and back; deeper, and saturated on the crown of the head, wings, and tail. Underneath, yellowish; sides of the abdomen bounded by gray, with an olivaceous cast. Throat and breast intensely yellow, marked with black lines, gradually wider at their lower extremity, and having a sagittateform. Eye encircled by a patch of blueish-gray. Bill brown; tip and lower mandible lighter, having a plumbeous hue. Feet brownish-gray. The white colour of the axillae shews itself in a small spot on the margin of the wing. Plumes of the hypochondriae, thighs, and vent, long, pendulous, and decompound.
Native of the Island of Sumatra ; whence it was sent to the Museum of the Honourable East India Company by Sir T, S. Raffles." ~ **Horsfield (1822)
| Single cite | ||
|---|---|---|
| ||
** |
|
| Original illustration of the Pin-striped Tit-Babbler from Horsfield (1822) (Source: Biodiversity Heritage Library) |
Intraspecific Variation
The broad geographic distribution of the Pin-striped Tit-Babbler means that there exists quite a considerable amount of intraspecific variation across its geographic range. As a result, a number of subspecies of the Pin-striped Tit-Babbler have been identified to account for the observed intraspecific variability.There currently exists 14 accepted subspecies of the Pin-striped Tit-Babbler (see Distribution)
| Single cite | ||
|---|---|---|
| ||
Clements, J. F., T. S. Schulenberg, M. J. Iliff, B. L. Sullivan, C. L. Wood, and D. Roberson. 2013. The Clements Checklist of the Birds of the World: Version 6.8. [Online.] Available at http://www.birds.cornell.edu/clementschecklist/download/. |
, although the differences between many races appear superficial, and several races are likely to be synonymised in the near future
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
The degree of variability between localised populations has thus given rise to a fair amount of confusion with regard to field guide illustrations since the choice of prototypical subspecies varies from book to book. King et al. (1975), for instance, base their description on race rubricapilla while Robson (2008) includes sulphurea, connectens and gularis
| Single cite | ||
|---|---|---|
| ||
King, B., M. Woodcock, and E. C. Dickinson. 1975. Birds of Southeast Asia. Page 480 in//. Periplus Editions (HK), Hong Kong. |
| Single cite | ||
|---|---|---|
| ||
Robson, C. 2008. A field guide to the birds of South-East Asia. Page 544 in. New Holland Publishers. |
. Another confounding factor stems from varying quality of illustrations across the different field guides. In particular, the illustrations in Robson (2008) barely resemble the Pin-striped Tit-Babbler at all (see Mixornis gularis sulphurea).
Here the descriptions of some of the more major subspecies are outlined.
Mixornis gularis gularis
The nominate subspecies of the Pin-striped Tit-Babbler, the race gularis// is found mostly in southern Peninsular Malaysia (including Singapore) and in Sumatra and the Riau Islands
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
- Crown: Dull chestnut
- Nape: Pale chestnut, paler than on crown
- Upperparts: Rufescent brown, slightly paler than nape
- Upperwing: Rufescent brown, slightly paler than nape
- Tail: Rufescent brown, slightly paler than nape
- Lores: Buffy, shading to grey-tinged pale yellow on supercilium and ear coverts
- Supercilium: Grey-tinged pale yellow
- Ear-coverts: Grey-tinged pale yellow
- Eyestripe: Narrow, brownish
- Chin and Throat: Pale yellow with sparse long blackish shaft streaks.
- Submoustachial area: Pale yellow with sparse long blackish shaft streaks
- Breast: Pale yellow with sparse long blackish shaft streaks
- Belly: Pale yellow
- Flanks: Washed olive
- Thighs and vent: Washed olive
- Iris: Yellowish-white to greyish brown
- Orbital skin: Bluish-lead
- Bill: Slaty, lower mandible paler
- Legs: Pale greyish-olive
|
| Source: Handbook of the Birds of the World (del Hoyo et al., 2007) |
Mixornis gularis connectens
Found along the coastal regions of the Gulf of Thailand from the Isthmus of Kra to Cambodia, the race connectens has slightly more olive upperparts than race gularis with a stronger yellow supercilium and slightly weaker breast streaks. Other similar subspecies include M. g. versuricola, M. g. inveterata, M. g. condorensis, M. g. archipelagica, and M. g. chersonesophila
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in// Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
| Single cite | ||
|---|---|---|
| ||
Wells, D. 2007. Birds of the Thai-Malay Peninsula: Passerines: Volume 2. Page 848 in. Christopher Helm Publishers Ltd. |
.
|
| Source: The Birds of the Thai-Malay Peninsula (Wells, 2008) |
Mixornis gularis rubicapilla
Found mostly around the Indian subcontinent in the lowlands of East Nepal and Northeast India, stretching out to the extreme North of Myanmar, the race rubicapilla is much paler and more olive than race gularis, with its crown tinged rufous, wings and tail pale olive-brown, supercilium and ear-coverts pale yellow, breast streaks weaker. Subspecies similar to rubicapilla include M. g. ticehursti
| Single cite | ||
|---|---|---|
| ||
King, B., M. Woodcock, and E. C. Dickinson. 1975. Birds of Southeast Asia. Page 480 in. Periplus Editions (HK), Hong Kong. |
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
|
| Source: Birds of Southeast Asia (King et al., 1975) |
Mixornis gularis sulphureaAnchor sulphurea sulphurea
The range of race sulphurea extends from East Mynamar to South China, including the North plateau of Thailand, and its plumage is similar to race rubicapilla, although brighter yellow on face to breast, with finer breast streaks
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in// Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
|
| Source: A Field Guide to the Birds of Southeast Asia (Robson, 2008) |
Mixornis gularis lutescens
The race lutescens is found in South China (Southeast Yunnan), North and East Thailand, Laos and Tonkin (North Vietnam), and is brighter yellow than the race sulphurea, with darker olive tinge on flanks, slightly darker cap, darker mantle. Similar races include M. g. kinneari and M. g. saraburiensis
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in// Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
 |
| Source: Handbook of the Birds of the World (del Hoyo et al., 2007) |
Mixornis gularis woodi**
Found on the islands of Balabac and Palawan in Southwest Philippines, the race woodi appears distinctively different from other races, and differs from gularis in having crown chestnut-greyish, face greyish, mantle, back and scapulars dark greyish, underparts much paler and breast-streaks almost absent
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in// Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
Owing to is distinctiveness and geographic isolation, the race woodi is likely to be split into a separate species in the near future.
 |
| Source: Handbook of the Birds of the World (del Hoyo et al., 2007) |
Similar Species
Mixornis bornensisAnchor bornensis bornensis
Formerly thought to be conspecific with Mixornis gularis, the Bold-striped Tit-Babbler has since been split into a separate species following Collar (2006)
| Single cite | ||
|---|---|---|
| ||
Collar, N. J. 2006. A partial revision of the Asian babblers ( Timaliidae ). Forktail 22:85–112. |
. Found on the landmasses of Borneo and Java, the Bold-striped Tit-Babbler possesses much darker and richer brown upperparts than the Pin-striped Tit-Babbler and the chest streaking is much more pronounced, with the chest colour a stony white rather than yellow and the chest-streaks thick and black. The flanks of the Bold-striped Tit-Babbler are also greyer than the Pin-striped Tit-Babbler
| Single cite | ||
|---|---|---|
| ||
Collar, N. J., and C. Robson. 2007. Family Timaliidae (Babblers). Pages 70–291 in Handbook of the Birds of the World: Vol. 12. Picathartes to Tits and Chickadees (J. del Hoyo, A. Elliot and D. A. Christie, Eds.). Lynx Edicions, Barcelona. |
.
|
| Source: Handbook of the Birds of the World (del Hoyo et al., 2007) |
Taxonomy and Systematics
Adapted from Clements Checklist 6.8 (2013)
Phylogeny
A hierarchical summary of the classification of the Pin-striped Tit-Babbler is as follows
Animalia
Chordata
Aves
Passeriformes
Timaliidae Vigors & Horsfield, 1827
Mixornis (Hodgson, 1842)
Mixornis gularis (Horsfield, 1822)
- Mixornis gularis rubicapilla (Tickell, 1833)
- Mixornis gularis ticehursti (Stresemann, 1940)
- Mixornis gularis sulphurea (Rippon, 1900)
- Mixornis gularis lutescens (Delacour, 1926)
- Mixornis gularis saraburiensis Deignan, 1956
- Mixornis gularis kinneari (Delacour & Jabouille, 1924)
- Mixornis gularis versuricola (Oberholser, 1922)
- Mixornis gularis connectens (Kloss, 1918)
- Mixornis gularis inveterata (Oberholser, 1922)
- Mixornis gularis condorensis (Robinson, 1920)
- Mixornis gularis archipelagica (Oberholser, 1922)
- Mixornis gularis chersonesophila (Oberholser, 1922)
- Mixornis gularis gularis (Horsfield, 1822)
- Mixornis gularis woodi (Sharpe, 1877)
Protonyms: Timalia gularis, Macronus gularis, Macronous gularis
Vernacular Synonyms: Striped Tit-babbler, Yellow-breasted Babbler
| |||||
The avian tree of life, with Babblers indicated in the red box. (Source: Jetz et al., 2012)
|
The Pin-striped Tit-Babbler was originally described in 1822 by Thomas Horsfield, an American physician who travelled extensively in Southeast Asia in the early 19th Century. His description of the Pin-striped Tit-Babbler was published in one of his most famous manuscripts: Zoological Researches In Java And The Neighbouring Islands, based on a specimen received from Sir Thomas Stamford Raffles belonging to the Museum of the Honourable East India Company. The specimen was later named named Timalia gularis and and subsequently placed within the family of the Old World Babblers (Timaliidae)
| Single cite | ||
|---|---|---|
| ||
Horsfield, T. 1822. Zoological Researches in Java and the Neighbouring Islands. Kingsbury, Parbury and Allen, London. |
.
Since its inception, however, the Old World Babblers has been a 'garbage bag' taxon for dumping difficult to classify species
| Single cite | ||
|---|---|---|
| ||
Cibois, A. 2003. Mitochondrial DNA Phylogeny of Babblers (Timaliidae). The Auk 120:35–54. |
. Owing to the relative taxonomic instability of the Old World Babblers, the classification of Mixornis gularis has undergone several revisions in recent years based on both morphological and phylogenetic studies. Most significantly, a study conducted by Moyle et al. (2012) based on an analysis of 6 genes (3 mitochondrial genes and 3 nuclear introns) revealed that the genus Macronus (sometimes spelled Macronous) - to which Mixornis gularis formerly belonged - is not monophyletic, with Macronus ptilosus and Macronus straticeps forming one clade and leaving Mixornis gularis in a weakly supported clade with the genera Dumetia, Timalia, and Rhopocichla. The splitting of the genus Macronus has resulted in the reclassification of the Pin-striped Tit-babbler under the formerly deprecated genus Mixornis
| Single cite | ||
|---|---|---|
| ||
Moyle, R. G., M. J. Andersen, C. H. Oliveros, F. D. Steinheimer, and S. Reddy. 2012. Phylogeny and biogeography of the core babblers (Aves: Timaliidae). Systematic biology 61:631–51. |
| Single cite | ||
|---|---|---|
| ||
Clements, J. F., T. S. Schulenberg, M. J. Iliff, B. L. Sullivan, C. L. Wood, and D. Roberson. 2013. The Clements Checklist of the Birds of the World: Version 6.8. [Online.] Available at http://www.birds.cornell.edu/clementschecklist/download/. |
.
|
| Thomas Horsfield, portrait by J. Erxleben (Source: Wikimedia Commons) |
Picture missing |
| Phylogeny of the Old World Babblers, showing the non-monophyly of the genus Macronus and the regrouping of the Pin-striped TIt-Babbler in a weakly supported clade with the genera Timalia and Dumetia (Source: Moyle et al., 2012) |
| Single cite | ||
|---|---|---|
| ||
Collar, N. J. 2006. A partial revision of the Asian babblers ( Timaliidae ). Forktail 22:85–112. |
Type Information
- Current name: Mixornus gularis rubicapilla
- Collection: University of Michigan Museum of Zoology
- Collecting data:
- Locality: India, Assam, Garo hills, Tura
- Sex: M
- Date: Jan 1829
- Collector: Koelz, Walter N.
- UMMZ #: 190725
|
| Dorsal View (Source: University of Michigan Museum of Zoology) |
|
| Ventral View (Source: University of Michigan Museum of Zoology) |
|
| Lateral View (Source: University of Michigan Museum of Zoology) |
Molecular Biology
Barcode Data: BOLD
The following is a representative barcode sequence for Mixornis gularis, showing the centroid of all available sequences based on 3 specimens, two from Myanmar and one from the Philippines (race of each specimen not specified).
There are currently 2 barcode sequences available from BOLD and GenBank. Below is a Cytochrome Oxidase Subunit 1 sequence from a member of the species
TGGCACTCTGTACCTAATCTTCGGTGCATGAGCCGGAATAGTTGGTACCGCCCTCAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGTGCCCTTCTAGGAGACGACCAAATCTACAACGTAATCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCCGACATAGCCTTCCCTCGAATAAACAACATAAGCTTCTGACTACTACCACCCTCCTTCCTCCTCCTCCTAGCATCCTCTACAGTGGAAGCCGGAGCAGGAACAGGATGAACCGTATACCCCCCTCTAGCAGGAAACCTGGCCCACGCTGGAGCCTCAGTCGACCTGGCCATCTTCTCCCTACATTTAGCAGGTATCTCCTCAATCCTAGGAGCTATCAACTTCATTACAACAGCAATTAACATAAAACCACCAGCCCTATCACAATACCAAACTCCACTGTTTGTCTGATCCGTCCTCATCACCGCAGTCCTACTCCTCCTATCCCTGCCTGTACTTGCCGCAGGTATCACAATACTCCTAACAGACCGTAACCTAAACACTACCTTCTTCGACCCCGCAGGTGGAGGGGACCCCGTACTATACCAACACCTA
Barcode Data: GenBank
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=181647
References
| Cite summary |
|---|
This page was authored by David Tan
Last curated in 2013