Page tree

Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.

Asian Ant Mantis

Odontomantis planiceps (de Haan, 1842)

Nymph of the Asian Ant Mantis. (Image by: Tiffany Lum)

Table of Contents
excludeAsian Ant Mantis
Life Cycle of Praying Mantids

Praying mantids are holometabolous insects, in which they undergo three main life stages: egg, nymphs, adults.  This is in contrast to holometabolous insects that have four life stages.

Comparison of holometabolous life cycle against hemimetabolous life cycle. (Images by: Tiffany Lum)


Ootheca

Similar to cockroaches, praying mantids lay their individual eggs in egg cases termed as ootheca.  Each ootheca is a huge investment by a single female because she invests in multiple offspring in one sitting.  The ootheca functions as a shield from environmental stressors such as temperature fluctuations and water damage

Footnote Macro

McMonigle, 2013

. Many mantids tend to lay on solid surfaces such as branches and stems. But due to the built up environment Singapore has, a lot of urban-adapted species lay their ootheca on surfaces like railings, walls, and windows (personal observation).

Morphology of ootheca have been known to have the potential for species delimitation, if not higher level taxa, due to the variation between different species

Footnote Macro

Breland & Dobson, 1947

Footnote Macro

Brannoch et al., 2017

.  However, ootheca morphology has been severely understudied throughout literature.  Below are some examples of other oothecae laid/formed by a few common local mantids to show how ootheca morphology can vary between species. 


Morphology of oothecae differs between mantids, images not to scale. (Images by: Tiffany Lum)

Widget Connector
urlhttps://www.youtube.com/watch?v=-UC3j_0Awn4&feature=youtu.be

Ootheca formation in Tenodera sp. (Video by: Tiffany Lum)

The emergence area is the location at which the nymphs will hatch from, and this area varies between different types of oothecae too.  During emergence, nymphs hang from strings that originate from emergence areas, and the nymphs gradually wiggle to free themselves.

Hatching process in an unidentified species (left) and in Rhombodera sp. (Images by: Tiffany Lum)

Widget Connector
urlhttps://www.youtube.com/watch?v=SuM7KbWWbVA

Hatching process in Hymenopus coronatus. Obtained from YouTube under Fair Use guidelines.


Nymphs

Although juvenile morphology is extremely important, it has been neglected in a lot of studies.  Many mantids look like ants during early nymphal stages.  Juveniles are also carnivorous and cannibalistic, as they prey on other arthropods and even their own kind.  Hence, they do have the same ecological significance as adults and deserve just as much attention in research that adults do.

Early instars in other mantises.  It is common for them to adopt ant mimicry too. Featuring: Amantis sp., & unknown mantis nymph (lower right).


The Amantis sp. nymphs resemble Oecophylla smaragdina in colouration (Images by: Tiffany Lum)


But there are also some early instars that don't mimic ants. Featuring nymphs of: Tropidomantis sp. (upper left), Leptomantella sp. (upper middle), Hierodula sp. (lower left & right), Deroplatys sp. (lower right). (Images by: Tiffany Lum)

Adults

The number of moults taken to reach adulthood differs greatly between species, ranging from 5 to more than 10 (personal observation). The lifespan of adults also differ greatly between species.  However, females tend to have longer lifespans than males in most species, but there are a number of exceptions

Footnote Macro

McMonigle, 2013

. Praying mantids also differ greatly in size (from less than 1cm as adults to 12cm) and not all species have wings that extend to the tip of their abdomen. Adult females are also able to store sperm from a single mating to fertilise multiple oothecae.  Contrary to popular belief, sexual cannibalism does not occur all the time (personal observations).

Reproduction

Most praying mantids undergo obligate sexual reproduction, in which they have to mate to produce offspring.  However, there are a few species that are known to be strictly parthenogenic such as Brunneria borealis, where the adult females do not need to mate and are able to produce 'asexually'. Some individuals are also facultatively parthenogenic, as they can engage in both sexual and 'asexual' reproduction.

Footnote Macro

Mantis Study Group, 1996

.

Life Cycle of Odontomantis planiceps

Just like all other praying mantids, O. planiceps has 3 life stages (egg, nymphs & adults).  This species strictly undergoes sexual reproduction to produce fertile ootheca and offspring.

4 stages in the life cycle of O. planiceps . (Image by: Tiffany Lum)

Ootheca

In O. planiceps, external dorsal walls of ootheca were white and foamy upon formation, but gradually developed into a hue of mustard yellow, with a coarse, scaly surface. They are formed from proximal to distal ends.  The emergence area is where the nymphs will hatch from the ootheca.  For each healthy ootheca laid by an O. planiceps, the hatchlings usually vary between 5 and 30 individuals (personal observation).

Labelled images of an O. planiceps ootheca. (Images by: Tiffany Lum)

Juvenile/Nymphs

How this species managed to get the common name is because of the uncanny ant mimicry that juveniles adopt

Footnote Macro

McMonigle, 2013

.  Using this form of mimicry, the young and almost defenceless nymphs are able to camouflage as ants as a defence mechanism

Footnote Macro
Huang et al., 2011

. Based on the image above, it is clear that many mantids look like ants during early nymphal stages, so it is unclear why only this particular species has been termed as an ant mantis. Males have 5 juvenile instars, while females have 6 (unpublished data).

Ant mimicry in this species only persists up to 3rd instar. From the 4th instar onwards, it becomes quite evident that they’re not ants.  In O. planiceps, early instar juveniles can be differentiated through differences in pigments of the raptorial forelegs (unpublished data).  Later instars can be determined through comparison of pigmented patterns in the compound eyes (unpublished data) and dorsal surface colouration. Subadults have enlarged wingbuds.

Labelled images of O. planiceps nymphs at different instars. (Images by: Tiffany Lum)


Odontomantis planiceps nymphs could possibly mimic Camponotus sp. of ants. (Image by: Tiffany Lum)


Adults

Adults were generally green with either brown or reddish-brown pigmentation on the wings.  Adults of O. planiceps have fully functional wings that extend to the tip of the abdomen, similar to most mantids. Males are highly mobile and quick to fly. Although capable of flight, the females rarely fly due to their gravid/enlarged abdomen.  This species exhibits sexual size dimorphism, in which females are larger than males (approximately 1.4cm for males and 2.0cm for females).

Adult female O. planiceps. (Images by: Tiffany Lum)

Adult male O. planiceps. (Images by: Tiffany Lum)

Keys available online described the genus as having: rounded bulging eyes, pronotum squat and shorter/as long as anterior coxa with poorly defined supra-coxal bulge, and non-dilated forefemor

Footnote Macro

Mantodea Species File Online, 1997

.  These traits were congruent with the morphology of imaged O. planiceps specimens. 

Female (left) and male (right) pinned specimens. (Images by: Tiffany Lum)




Interactions of Praying Mantids

With prey (Diets of mantids)

Mantids are generally stalking or ambush predators, and are only known to eat live prey.  Some aggressive individuals have been known to take down insects as large as them, which includes their mates, lizards, fishes, and small birds

Footnote Macro

Battiston et al., 2018

.  Many predatory insects can be beneficial in agricultural pest suppression.  For example, Tenodera sinensis was introduced into North America as a form of biological pest control

Footnote Macro

Frank, 2015

.  Afterall, mantids are extremely voracious feeders and are able to eat a wide variety of prey items.  Some mantids have even able to gut the toxic innards of caterpillars

Footnote Macro

Mebs et al., 2017


Praying mantids catch prey using a quick striking motion with their raptorial forelegs to grip the prey item, and accuracy is usually high.  However, there are times where the prey are quick to flee or the mantid has generally poor aiming skills.

Widget Connector
urlhttps://www.youtube.com/watch?v=jffsDmdXaOg&feature=youtu.be&t=30
Widget Connector
urlhttps://www.youtube.com/watch?v=tNZcj3Ob3vQ
Widget Connector
urlhttps://www.youtube.com/watch?v=MLZH0Zp51hg

Widget Connector
urlhttps://www.youtube.com/watch?v=4dMeqxeMen8&feature=youtu.be&t=28
Widget Connector
urlhttps://www.youtube.com/watch?v=ysHoU_jHe5Q
Widget Connector
urlhttps://www.youtube.com/watch?v=M990XX9mSxM

Various videos of praying mantids catching prey items using their raptorial forelegs. (Videos by: Tiffany Lum)

With predators (Mantids as food)

Mantids have a single ear located at the ventral metathorax

Footnote Macro

Yager & Hoy, 1986

.  Although it only provides non-directional hearing, it is known to be extra sensitive to ultrasonic sounds. When it senses ultrasonic frequencies commonly used by bats that navigate and forage using echolocation, the mantis is able to fly downwards in a spiral, which helps them to escape predation

Footnote Macro

Triblehorn & Yager, 2002

.

Location of the mantis ear. (Images by: Tiffany Lum)


Mantids are also a common prey item for other carnivores such as birds.  Recently, Fluffy, an albino kingfisher has been in the spotlight among birders due to its’ unusual colouration and concern for its’ ability to hunt independently. Photographers have captured moments that praying mantids were fed to Fluffy.  However, there is very little research on the list of predators that prey on mantids, and it can be assumed that most insectivores will consume mantids when the opportunity arises.

Fluffy being fed with an adult mantid. (Permission pending)

With parasites (Mantids as victims)

Horsehair Worms

Horsehair worms are one of the most visible parasites that people often associate with mantids, most likely due to the gruesomeness of its emergence.  However, they are not known to be common in Singapore (personal observation).  The worms are parasitic nematomorphs that have a free living stage, intermediate host stage, and the intermediate hosts are consumed by mantids which end up being the final host that gets killed upon emergence of the parasite

Footnote Macro

Schmidt-Rhaesa & Ehrmann, 2001

.  The parasite spends the free-living stage in water bodies, hence the intermediate stages only affect insects that spend a portion of their lives in water (ie. insects that develop in water bodies as nymphs).

Widget Connector
urlhttps://www.youtube.com/watch?v=JLR14-fsDIU

Obtained from YouTube under Fair Use guidelines


Tachinid Flies

Tachinid flies have been recorded to lay their eggs on juvenile mantids and the larvae then boring into the hosts’ body

Footnote Macro

Young, 2009

Footnote Macro

O'Hara, 2008

. Symptoms of this form of parasitism include delayed moults and swelling of the mantid’s abdomen. Upon emergence, the individual mantids all died within 48 hours. These larvae burrow in soil and pupate. Exoristinae and Tachininae are known to parasitise praying mantids, but there has been insufficient research on host specificity particularly in the tropics

Footnote Macro

O'Hara, 2008

.  However, they have been known to have lower levels of host specificity compared to hymenopteran parasitoids. This type of parasitism has been observed within Singapore (unpublished personal observations), but remains understudied.

Pupa of a tachinid fly. (Image by: Tiffany Lum)

Tachinid fly that emerged. (Image by: Tiffany Lum)


Ootheca Parasitism

Chalcid wasps have been known to parasitise ootheca of mantids too.  These wasps oviposit into the egg chambers of ootheca, the eggs of the wasp hatch into larvae that feed on the mantid's eggs, and wasp offspring emerge from small holes from the ootheca

Footnote Macro

Fagan & Folarin, 2001

Footnote Macro

Panis & Laudeho, 2008

.This tends to reduce the number of individuals that hatch from the ootheca.  Depending on the severity of parasitism, some ootheca might not even be able to yield any offspring.  Recent observations and studies on these wasps have been conducted in regions outside Singapore and Malaysia, and the behaviour and life cycle of the North American Podagrion mantis has been fairly well studied by Breland

Footnote Macro

Breland, 1941

. These wasps have been found to parasitize multiple host species, and all species of Podagrion are known to oviposit solely in the ootheca of praying mantises 

Footnote Macro

Coombs, 1994

Footnote Macro

Fox, 1939

Such parasitism has been observed around Singapore

Footnote Macro

Lum & Ho, 2018

, but further studies need to be done to obtain information on species level identification, susceptibility of different ootheca structures, prevalence, specificity of different species, and much more information.

Chalcid wasp, suspected Podagion sp., ovipositing in the ootheca of a Tenodera sp. (Images by: Nicholas Lim)

Podagrion sp. that emerged from a Tropidomantis sp.ootheca. (Images by: Tiffany Lum)

With humans (Mantids in pet trade)

Praying mantids are commonly kept as pets in other countries and are even sold in pet shops.  These countries are often in temperate regions only.  Pet shops tend to stock a wide variety of arthropods, which includes both pet insects and feeder insects, making mantid rearing a breeze.  However, such privileges and access to a wide variety of feeder insects are not available in Singapore, making mantid rearing here difficult.

Mantids are known to be highly susceptible to inbreeding effects, and cultures of similar genetic lines usually do not persist past the 3rd generation.  Hence, it is common practice among breeders to trade individuals or capture a few individuals from the wild to outbreed the existing cultures.

For O. planiceps

Feeding behaviour of O. planiceps individuals are similar to most other mantids as described above. Owing to the lack of research on this particular species, only speculations can be made about the parasitism of these individuals

Footnote Macro

Lum, 2018

As mentioned earlier, there have been no known studies of specific predators of O. planiceps or praying mantids in general, and it can be assumed that insectivores consume them. O. planiceps has been known to be one of the easier species to rear and is in the pet trade too

Footnote Macro

McMonigle, 2013

Footnote Macro

Mantis Place

. However, O. planiceps is a tropical species and most countries that have a booming pet trade for praying mantises tend to be temperate regions.  This makes it difficult for them to have a consistent supply of wild individuals to add to the gene pool as the breeders need to travel to the tropics to import them.  Hence, inbreeding becomes a huge problem that leads to the subsequent downfall of the O. planiceps stocks (personal communication with multiple breeders). If you take a look at a website that sells O. planiceps, live stocks are not available

Footnote Macro

Mantis Place

.






Mantis, mantises, mantid, mantids?

There is a fine line between the correct and incorrect usage of these words.  To make things more confusing than it already is, Mantis is a genus

Footnote Macro

University of Kentucky College of Agriculture

. Moreover, Mantidae is a family-level taxonomic rank, and it is usually common to refer to individuals in the family without the '-ae' suffix (for example, individuals in family Sepsidae can be called sepsids).  Hence, there are arguments about whether or not it is right to use the term 'mantis' or 'mantid'.  However, both terms are still very widely used in literature because it is definitely much easier to drop the word 'praying' that precedes it because both 'mantis' and 'mantid' are known to refer to praying mantids

Footnote Macro

English Language and Usage, 2015

Footnote Macro

The American Heritage Dictionary of the English Languge

. 'Mantises' and 'mantids' are widely accepted as the plural forms of the 'mantis' and 'mantid' respectively

Footnote Macro

English Language and Usage, 2015

Footnote Macro

The American Heritage Dictionary of the English Languge

.

Another common occurence is calling them 'preying mantises', which is understandable because they indeed do prey on other living things.  However, 'praying' is more widely accepted and prevalent in literature use, due to the posture assumed by all individuals in the order Mantodea. 




Etymology

The genus name is a combination of the prefix Odonto- (from Greek word odous, meaning “tooth”) and Mantis, while the species planiceps is derived from a combination of Latin words - planus (meaning “flat”) and ceps (meaning “head”).




Where to find O. planiceps

These mantids seem to be able to thrive in highly disturbed environments and also in conserved areas.  They can be considered as one of the more urban species, which are more mobile and can be found in areas with very little vegetation. Plant-associations have also not been observed in this species.  Being diurnal, this species tends to be easier to locate in the day.

Odontomantis planiceps have been observed in Singapore, Malaysia, Indonesia, Thailand, Taiwan, Hongkong and India based on information obtained from iNaturalist

Footnote Macro

iNaturalist, 2018

.  However, iNaturalist only contains information contributed by citizen science and could be inaccurate.  Proper studies to determine global distribution of O. planiceps has not been conducted. 

Screenshot of the map of Singapore, taken from iNaturalist (Permission granted). Red markers indicate the location of O. planiceps sightings reported by iNaturalist users, purple markers indicate locations that O. planiceps were personally observed. (Image from: iNaturalist, edited by: Tiffany Lum)




Comparison to other local mantids

Being a biodiversity hotspot, it is expected that Singapore is home to a number of other small mantids too.  However, O. planiceps can easily be differentiated from them based on the pigments on the whole body, and also the shape of the head.

Acromantis sp. (left), Amantis sp. (center) & Tropidomantis sp. (right) are all common small mantids in Singapore. (Images by: Tiffany Lum)





Phylogeny

Lineage

Family Hymenopodidae

Praying mantises of the Hymenopodidae family include fascinating camouflages to blend with vegetation and disguise body profiles. Some species even exhibit variously sized cuticular leg expansions appearing as lobes that resemble foliage

Footnote Macro

Svenson et al., 2016

. The famous orchid mantid (Hymenopus coronatus) belongs to this family too, and has been observed to resemble flowers and attract more pollinators than an actual flower does


Footnote Macro

O’Hanlon et al., 2013

.  Below are some examples of Hymenopodids, showcasing their astounding mimicry.

Creobroter sp. (left), and Hymenopus coronatus (center and right). (Images by: Tiffany Lum)


Phylogenetic Tree

Parsimonious trees have shown fairly strong support in the evolutionary history of Odontomantis in relation to other closely related taxa. Strict consensus cladograms obtained from the trees were well supported by morphological variation.  This includes traits such as secondary elongation of female wings (Node 75), number of cercomeres (Node 73), and postero-ventral fore tibial spines being laid down (Node 77).  However, there has been no studies on the species level phylogeny.

Image adapted from Wieland, 2013. Support values below 100 are in black boxes. Nodes without black boxes are 100.

Footnote Macro

Wieland, 2013

COI Barcode

No Format
TTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCCCATGCATTCATCATAATTTTCTTCATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCACCATCAATTGTTCTTCTTATTTTAAGAAGAACAATTGAAAGAGGTGCAGGTACAGGATGAACAGTTTATCCTCCTTTATCCGCAAGAATTGCTCATGCCGGCCCTGCAGTGGATTTAACTATTTTTTCATTACATTTAGCTGGTATATCGAGAATTATAGGAGCTGTAAATTTTATTACAACTATACTTAATATAAAACCAATTTATATAAATCAATCACAAATACCTTTATTTGTATGATCAGTAGGAATTACCGCATTACTTCTATTATTATCTTTACCAGTATTAGCTGGTGCAATCACAATATTATTAACTGATCGAAATATTAATACATCATTTTTCGACCCAGCAGGAGGTGGTGATCCAATCTTATATCAACACTTATTTTGATTTTTTGGTCA

From unpublished data.




Taxonomy

Sometimes, different names are assigned to the same species, especially when a species that has already been described earlier was described again.  The names that come after the initial naming and descriptions are considered as junior synonyms and should not be used in nomenclature.

In the case of Odontomantis (Saussure, 1871) as a genus, Antissa (Stal, 1871) and Euantissa (Giglio-Tos, 1927) were classified as junior synonyms. This was because the description of the genus Antissa and Euantissa were synonymous with Odontomantis , which was described first. For species-level names, javana (Saussure, 1870) was classified as a junior synonym.  Hence, the species should be referred to as Odontomantis planiceps (de Haan, 1842).

Unfortunately, a wide variety of names have been incorrectly used to describe the species.  It is not uncommon to come across information describing Euantissa sp

Footnote Macro

Encyclopedia of Life

Footnote Macro

Tree of Life web project

.  Moreover, citing wrong taxonomists have been quite prevalent too, with people calling citing the species as Odontomantis planiceps (Giglio-Tos, 1913)

Footnote Macro

Academic Dictionaries and Encyclopedias

, despite de Haan (1842) being the actual taxonomist that described this species.

The original species description cannot be found, but the genus description can be found in the Biodiversity Heritage Library.

Footnote Macro

Wytsman & Townsend, 1934

Screenshot of genus description in Genera Insectorum

Footnote Macro

Wytsman & Townsend, 1934

.

Type specimens

As opposed to information stated on Mantodea Species File Online

Footnote Macro

Mantodea Species File Online

, personal communication with curators from Natural History Museum of Geneva revealed that the female specimen has been transferred to RMNH Leiden (Naturalis Biodiversity Center in Leiden). The syntype for O. javana (female) and male holotype filed under O. planiceps are currently stored in RMNH Leiden.




References

Display Footnotes Macro