Pigeon Fly

Pseudolynchia canariensis (Macquart, 1839)

Figure 1: Dorsal(Left) and ventral(Right) images of the Pigeon fly. Image Credit: Leshon Lee

To the untrained eye, the pigeon fly may look like any other ordinary fly... However, as you will discover, there is more to this fly than meets the eye!

Biology of Pigeon Fly

Live birth in flies??

Unlike most flies, pigeon flies “give birth” to their offspring instead of laying eggs. A mother fly "gives birth" to only one offspring maggot at a time. A single egg will hatch inside the fly’s uterus and feed on the secretions from the “milk glands” within the abdomen of the mother. After the 3rd larval instar stage and when the larvae has reached its maximum size, it forms a prepupa or a puparium. The mother will then “give birth” to it. Shortly after leaving the mother’s body, the prepupa will harden to form a brown puparium. The puparium are generally found around bird's roosting sites or even on the birds themselves. Finally, it will undergo complete metamorphosis and emerge as a young adult¹ . 

                                                                                                                                      Figure 3: Life cycle of the pigeon fly.                                                                                                                                                   Image Credits: Leshon Lee(Adult fly), Karen Wheeler, University of Florida(White Prepupa), Foo Mao Sheng (Darkened Pupa)

Figure 4: White prepupa (Mature 3rd larval instar which has stopped feeding and immediately begins to form a puparium when it is delivered by the mother), brown pupa and an adult pigeon fly. Image Credits: Karen Wheeler, University of Florida.(Pending Permission)

A mother's dedication 

The mother pigeon fly has to provide nutrients for her young until it emerges from the mother's body. Moreover, the prepupa would have to be of a similar mass to the mother itself, otherwise the young would get smaller with each generation. Imagine giving birth to a baby the same size as you! These flies would go through that 10 to 20 times throughout their lives. This shows the mother's commitment to passing her genes on to the next generation, no matter how tough it may be.

Parasitism

The pigeon fly's main host is the pigeons and doves from the Order Columbiformes. It has piercing mouthparts that punctures the skin of the bird and sucks the blood of its host. With its ability to fly from one bird host to another, the Pigeon fly has been found on many other bird hosts from the Orders Ciconiiformes, Falconiformes, Cuculiformes, Strigiformes, Coraciiformes, and Passeriformes.²

Figure 5: Piercing mouthpart of the pigeon fly. Image credits: Leshon Lee

Disease Vector

Pigeon flies have been known to be a carrier of Haemoproteus columbae, a protozoan that causes pigeon malaria, around the world. However, it is not known if it is present in Singapore.

Figure 9: General life cycle of Haemoproteus. Image credit: Pinterest⁴

Pigeons will be infected when bitten by a Pigeon fly that carries Haemoproteus columbae. The sporozoites from the saliva of the fly enters the blood stream and invade the endothelial cells of the blood vessels of the lungs, liver and spleen. They then congregate to form schizonts. Each schizont will multiply to form 15 or more small, unpigmented bodies known as cytomeres, each with a single nucleus. Each cytomere grows still further, and its nucleus undergoes multiple fission. Eventually, the host cell becomes considerably hypertrophied (enlarged) and is filled with a number of multinucleate cytomeres. The endothelial cells break down, releasing the cytomeres, which accumulate in the capillaries, ocassionally resulting in complete blockage. They are irregularly shaped and tortuous, and may send out branches along the capillaries, becoming bifurcate, trifurcate or even multiradiate. Each cytomere produces an enormous number of merozoites, which infects the ethyrocytes (Red blood cells) of the pigeon and develop into gametocytes.⁵ Another Pigeon fly may feed of the infected bird's blood, resulting in the Pigeon fly being a vector. The gametocytes will then continue its life cycle in the midgut of the fly by maturing and sexually reproducing to form an encapsuled zygote known as an oocyst. The oocyst will rupture and infect the salivary glands of the pigeon fly, ready to infect its next pigeon host.

Do pigeon flies feed on humans?

It may seem like an obvious answer but a daring study in 1931 done by G. Robert Coatney found that the Pigeon fly is able to feed on humans! Coatney recruited 2 friends to carry this experiment out by forcing the flies to bite them and suck their blood, effectively becoming the host for the flies. However, they only feed on human blood when there is a lack of choice, on in this case, when being forced to. A red and itchy bite mark appeared which persisted for 6 days, 9 days, and 20 days for Coatney and his friends respectively. The reason for the variation in the number of days taken for the appearance of the bite mark is unknown and such an experiment has never been repeated since then

By having a diet of only human blood, the flies could not survive for long or reproduce. The male Pigeon fly lived for 12 days while the female Pigeon fly lived for 7 days and never produced larvae.⁶ This effectively shows that the Pigeon flies are host specific and only by feeding on birds will they be able to survive and reproduce. Therefore fret not! Unless pigeons have been wiped out throughout the world, humans do not have to worry about these little critters sucking our blood and potentially transmitting deadly diseases to us.

Is it also a vector for human diseases?

The pigeon fly belongs to the Superfamily Hippoboscoidea together with the infamous tsetse fly. The tsetse fly is a vector for the African trypanosomiasis, also known as the sleeping sickness. It is caused by the parasite,Trypanosoma brucei, which is dispersed by the tsetse fly to humans living in Central Africa. If not treated, the sleeping sickness can be lethal.⁷ Thankfully, the tsetse fly's geographical distribution is only within Central Africa. However, since the pigeon fly is a close relative to the tsetse fly, some scientists are conducting research to find out if the pigeon flies also carry trypanosomes since it may also result in a disease outbreak all over the world! Till then, it is still not known if the pigeon fly is a vector for human diseases.

Distribution

Pigeon flies are a cosmopolitan species and are found everywhere in Singapore and in most parts of the world (mainly subtropical and tropical) where pigeons can be found. Currently, the pigeon fly has only been found on the Rock Pigeon (Columba livia) and the Pink-Necked Green Pigeon (Treron vernans) in Singapore. More studies and counts are needed to establish the distribution of the pigeon fly in Singapore.

Figure 10: Known occurances of Pigeon Fly. Photo credits: Wikimedia Commons. Edited by: Leshon Lee

Taxonomy of Pigeon Fly

Original Description

The pigeon fly was first described by Justin Pierre Marie Macquart, a french entomologist specialising in Diptera, in 1839 as Olfersia canariensis.

Figure 11: The original description of the pigeon fly.⁸  Image credits: Bibliothèque nationale de France

Type Information

When the pigeon fly was described, the concept of a holotype had not been establised. Since syntypes are allocated to species when no holotypes were assigned, the pigeon fly was designated a syntype, which is stored at the Muséum National d'Histoire Naturelle in Paris. 

Figure 12-14 (Left to right): Image of Pseudolynchia canariensis syntype. Image credits: Muséum National d'Histoire Naturelle (Creative Commons).⁹

Identification

If you ever find a fly scurrying around the feathers of pigeons, it is most likely a pigeon fly. Here are a few specific morphological features to identify them!

The pigeon fly is dorsoventrally flattened which allows the fly to slide between feathers and hide amongst them to avoid detection10 .
4 claws on each of its 6 legs to hook tightly onto the bird host10 .
Presence of piercing mouthpart to penetrate the bird host's skin and suck their blood. Its mouthpart is directed forwards rather than downwards10 .
Legs are robust with enlarged femora, thus showing its reliance on the legs are scurrying amongst the feathers10 .

Figures 15-19(Left to Right): Illustrations of a Pigeon fly and its morphology. Fig. 16(A): Wing. Fig. 16(B): Head. Fig. 16(C): Puparium (Top view). Fig. 16(D): Puparium (Side view). Fig. 16(E): Puparium respiratory lobes. Fig. 16(F): Male terminalia. Fig. 16(G-H): Dorsal basal area of abdomen. Fig. 17(A): Dorsal and ventral thorax, basal area of left wing. Fig. 17(ALU): Alula. Fig. 17(AN+): Combined anal, 3rd posterior and axillary cells of the wing. Fig. 17(AXV): Axillary vein. Fig. 17(2B+): Combined 2nd basal and 2nd posterior cells of the wing. Fig. 17(CO): Costa. Fig. 17(DCL): Upper Calypter. Image Credit: Smithsonian National Museum of Natural History, Department of Entomology.¹¹

Classification

Kingdom: Animalia

Phylum: Arthropoda

Class: Insecta

Order: Diptera

Family: Hippoboscidae

Genus: Pseudolynchia

Species: canariensis

Name

Binomial name: Pseudolynchia canariensis Macquart, 1839

Vernacular name: Pigeon fly

Synonyms: Lynchia simillima Speiser, 1904  

                  Olfersia canariensis Macquart, 1839

                  Olfersia capensis Bigot, 1885      

                  Olfersia exornata Speiser, 1900

                  Olfersia falcinelli Rondani, 1879

                  Olfersia lividicolor Bigot, 1885   

                  Olfersia maura Bigot, 1885         

                  Olfersia rufipes Macquart, 1847

                  Olfersia testacea Macquart, 1843

Nomenclature History 

The pigeon fly was first described by Macquart as Olfersia canariensis in 1839. Since then, many other entomologists such as Bigot, Speiser, and even Macquart himself have still redescribed the pigeon fly under the genus Olfersia.Subsequently, the genus Olfersia was split and in 1929, Pseudolynchia was described by Bequaert¹² . The pigeon fly was eventually placed under the genus Pseudolynchia.

Why is the genus called Pseudolynchia?

Pseudolynchia literally means "fake Lynchia". According to Maa(1966), the genus Psuedolynchia is closely related to Lynchia sensu Bequaert 1926 and particularly to Microlynchia Lutz 1915 and its only unique character is the presence of finger-like processes on scutellum¹³ . The sexual dimorphism, vibrissal and metabasisternal processes, facial and prescutal pilosity and posterior scutellar truncation are shared by some of the Lynchia species-groups; whereas the venation and abdominal features are similar to those in Microlynchia¹³ . Therefore, Pseudolynchia stands most probably intermediate of Lynchia and Microlynchia and may be considered primarily an Old World counterpart of the latter¹³ . 

Cytochrome C Oxidase Subunit 1 Gene 313 Basepair Barcode

The 313 basepair barcode of the Cytochrome Oxidase 1 gene was amplifed using the jgHCO2198 primer by Leshon Lee (unpublished)¹⁴ .

The 313 base pair barcode is as shown below:

5’- AAATAAATGTTGATATAAAATAGGATCTCCTCCTCCGGCTGGATCAAAAAATGATGTATTAAAATTTCGATCTGTTAATAGTATAGTGATTGCTCCAGCTAATACAGGTAATGATAATAATAATAAAAGTGCAGTAATTACTACGG

ATCAAACAAATAAAGGTATTCGATCAAATGAAATTCCTGTTGAACGTATATTAATTACAGTAGTAATAAAATTTACTGCTCCTAAAATAGATGAAATTCCTGCCAAATGGAGTGAAAAAATAGCTATATCAACTGAAGCTCCTCTGT

GAGCAATAGTTGATGAAAGA -3’

Phylogeny

Figure 20: Phylogenetic tree of Hippoboscoidea showing bootstrap values and posterior probability.¹⁵ Top line shows bootstrap values and posterior probability respectively.

Petersen et al. (2007) sequenced a 760 bp fragment of the carbamolyphosphate synthetase (CPS) region of the CAD gene(also known as "rudimentary" in Diptera), 2kb of 28s DNA, and partial sequences of Cytochrome Oxidase 1(CO1) gene and 16s rRNA. This tree was built by Petersen et al. (2007) using maximum parsimony and Bayesian inference. Bootstrap values as shown in fig. 19 are generally high, thus showing high support for the nodes. The node containing Pseudolynchia canariensis has a bootstrap support value of 86 which shows that it is pretty well supported. However, the bootstrap values within the clade Ornithomya are less than 50. Additionally, the posterior probability values using Bayesian inference are generally high, with a value of 1.0 (Maximum value showing strongest support) for the node containing Pseudolynchia canariensis. However, those values should be taken with a pinch of salt because posterior probabilities have been criticized for providing an overestimate of support¹⁶ .

According to one of the authors, Bayesian analysis was used as there were no Maximum Likelihood softwares available in 2007 that could handle a good bootstrap analysis for the dataset. More genes could also be sequenced to build the phylogenetic tree to see if those initially poorly supported nodes would have a higher bootstrap/ posterior probability value after factoring in more genes.

Figure 21: Phylogenetic trees showing bootstrap values and posterior probability(Top) and key evolution events(Bottom) of Hippoboscoidea.¹⁵

As seen in fig. 21, viviparity, which is the retention and growth of the fertilized egg within the maternal body until the young animal, as a larva or newborn, is capable of independent existence, has evolved very early on in the phylogenetic tree, resulting in presence of viviparity in all organisms within Hippoboscidea. However, at that time, the larvae were still able to move. It was only when "true" ectoparasitism evolved, then the larvae had reduced movement, resulting in the change from the larvae burrowing into the soil to pupate like the flies in the Glossinidae family to becoming incapable of burrowing and in some cases pupate within the mother's body. The host shift to bird evolved independently in the tree, thus showing convergent evolution. 

Simmons, M. P., Pickett, K. M., & Miya, M. (2004). How meaningful are Bayesian support values?. Molecular Biology and Evolution, 21(1), 188-199.

Glossary

Amblyceran lice : Lice from the most primitive group of chewing lice that specialises on both birds and mammals.

Bifurcate : Divide into 2 branches or forks.

Commensalism : An association between two organisms in which one benefits and the other derives neither benefit nor harm.

Dorsal : The upper side or back of an animal, plant, or organ.

Dorsoventrally flattened : Flattened along the dorsoventral axis.

Endothelial cells : Cells that line the interior surface of blood vessels and lymphatic vessels, forming an interface between circulating blood or lymph in the lumen and the rest of the vessel wall. 

Gametocytes : A eukaryotic germ cell that divides by mitosis into other gametocytes or by meiosis into gametes during gametogenesis.

Holotype : A single physical example (or illustration) of an organism, known to have been used when the species (or lower-ranked taxon) was formally described.

Ischnoceran lice : Lice from a group of chewing lice that specialises mainly on birds, with a small family specialising on mammals.

Merozoites : A sporozoan trophozoite produced by schizogony that is capable of initiating a new sexual or asexual cycle of development.

Morphological features : Forms and structural features of an organism

Puparium : The hardened last larval skin which encloses the pupa in some insects, especially higher diptera.

Schizont : A cell that divides by schizogony to form daughter cells.

Scutellum : The posterior portion of either the mesonotum or the metanotum of an insect thorax.

Sporozoite : A motile spore-like stage in the life cycle of some parasitic sporozoans (e.g. the malaria organism), which is typically the infective agent introduced into a host.

Syntype : Any one of two or more biological types that is listed in a description of a taxon where no holotype was designated.

Trifurcate : Divide into 3 branches.

Ventral : The underside of an animal or plant; abdominal.

References

This page was authored by Leshon Lee (A0166748M)
Last curated on 02 January 2019